Fecha | Título |
---|---|
mié, 25 dic 2024 | BENEFICIAL SALTS FOR ENHANCING BIOCONTROL EFFICACY OF FUNGAL SPORESThe present invention refers to the use of salts to enhance efficacy of fungal spores and preparations comprising the same. Fuente: WIPO "stone fruits" |
jue, 21 nov 2024 | IMPROVEMENT OF STONE FRUIT QUALITYThe present invention is directed to methods of improving cold stress tolerance in a stone fruit comprising applying an effective amount of a mixture of abscisic acid and a jasmonate [...] Fuente: WIPO "stone fruits" |
jue, 21 nov 2024 | STONE FRUIT QUALITYThe present invention is directed to methods of improving cold stress tolerance in a stone fruit comprising applying an effective amount of a mixture of abscisic acid and a jasmonate [...] Fuente: WIPO "stone fruits" |
jue, 7 nov 2024 | PROCESS FOR PRODUCING PLANT SEED MATERIAL HAVING A REDUCED CONTENT OF CYANOGENIC COMPOUNDSA method for producing plant seed material having a reduced content of cyanogenic compounds from at least partially deoiled plant seeds, wherein the at least partially deoiled plant [...] Fuente: WIPO "stone fruits" |
mié, 11 sep 2024 | A HARVESTING SYSTEM AND METHOD FOR AUTONOMOUS HARVESTING OF FRUITThe invention relates to a harvesting system for autonomous harvesting of fruit, such as for instance pome fruit such as apples or stone fruit, comprising:- at least one collecting subsystem [...] Fuente: WIPO "stone fruits" |
jue, 8 ago 2024 | INSECT, ACARINA AND NEMATODE PEST CONTROLThe present invention relates to combinations of a compound of formula (I), wherein: R1 is hydrogen or fluorine; and R2 is: in which n is 0, 1 or 2; with a compound selected from a group [...] Fuente: WIPO "stone fruits" |
jue, 20 jun 2024 | COMPOSITIONS AND METHODS FOR IMPROVING PLANT HEALTH AND CONTROLLING PLANT DISEASECompositions and methods for controlling a plant pest or for treating or preventing plant disease are provided. Such compositions and methods comprise a bacterial strain that controls [...] Fuente: WIPO "stone fruits" |
jue, 23 may 2024 | MICROBIAL COMPOSITIONS AND METHODSThe present disclosure provides novel compositions and methods comprising one or more microbes and uses thereof. The present disclosure further provides compositions and methods for [...] Fuente: WIPO "stone fruits" |
jue, 16 may 2024 | POLYPLOID HYBRID BREEDINGThe present inventions relate to a breeding system for the production of polyploid seeds, plants, or plant parts where cycles of meiosis, syngamy, and selection are used for interpopulation [...] Fuente: WIPO "stone fruits" |
jue, 2 may 2024 | INSECT AND ACARINA PEST CONTROLThe present invention relates to a method of controlling or preventing damage to a plant, which comprises applying on the plant, the locus thereof or its propagation material a combination [...] Fuente: WIPO "stone fruits" |
jue, 4 abr 2024 | A POST-HARVEST SOLUTION FOR AGRICULTURAL PRODUCEThe present invention relates to a combination, a composition, and an application method thereof for preventing or decreasing post-harvest spoilage or decay and extending shelf life [...] Fuente: WIPO "stone fruits" |
jue, 28 mar 2024 | COMBINATIONS OF KETO-ENOL INSECTICIDESThe present invention provides a combination comprising an amount of a keto-enol insecticide, especially spirotetramat, spiromesifen, spirodiclofen or spiropidion, and an amount of a [...] Fuente: WIPO "stone fruits" |
jue, 26 oct 2023 | EDIBLE OIL-IN-WATER NANOEMULSION FORMULATIONS FOR PREHARVEST TREATMENT AND/OR POSTHARVEST PRESERVATION OF FRUITS OR VEGETABLESThey are prepared by a high energy method (e.g. by sonication) from: an oily solution of edible oils (e.g. high-oleic sunflower oil) as solvent, with melatonin (e.g. 100 µM) and edible [...] Fuente: WIPO "stone fruits" |
jue, 19 oct 2023 | Method for Producing a Pumpable Paste from the Seeds of Nut or Stone FruitsA method for preparing a pumpable batch composition of stone fruit and/or nut fruit seeds, in particular nuts, almonds or nut and almond mixtures, with the following steps: Breaking [...] Fuente: WIPO "stone fruits" |
mar, 3 oct 2023 | Cleaning, peeling and cutting device for stone fruitsA stone fruit cleaning, peeling and cutting device belongs to the field of fruit processing machinery and structurally comprises a conveying module, a clamping module, a storage module, [...] Fuente: WIPO "stone fruits" |
jue, 17 ago 2023 | BIO-CONTROL COMBINATIONS, COMPOSITIONS AND METHOD OF USEThe present invention relates to bio-control combinations and compositions thereof. The biocontrol combinations accordingly comprise an antagonist yeast and a bicarbonate salt for effectively [...] Fuente: WIPO "stone fruits" |
jue, 10 ago 2023 | FUNGICIDAL COMBINATIONSThe present disclosure relates to a fungicidal combination comprising at least one quinoline fungicide and at least one anilinopyrimidine fungicide. The present disclosure also relates [...] Fuente: WIPO "stone fruits" |
jue, 22 jun 2023 | BENEFICIAL ACIDS FOR ENHANCING BIOCONTROL EFFICACY OF FUNGAL SPORESThe present invention refers to the use of acids to enhance efficacy of fungal spores and formulations comprising the same. Fuente: WIPO "stone fruits" |
jue, 1 jun 2023 | Pseudomonas strains and their metabolites to control plant diseasesThe present disclosure concerns methods of using novel bacterial strains of 0617-T307, 0917-T305, 0917-T306, 0917-T307, 0118-T319, 0318-T327, and 0418-T328, the cell broth and novel [...] Fuente: WIPO "stone fruits" |
jue, 27 abr 2023 | NUT PRE-SHELLERA stone fruit nut pre-sheller (1) comprising a frame (2) having first (3) and second ends (4) with a roller (5) rotatably mounted between them with drive means at a free end thereof, [...] Fuente: WIPO "stone fruits" |
mar, 18 abr 2023 | Kernel removing machine for stone fruitsThe utility model provides a pitting machine for stone fruits, and relates to the technical field of stone fruit processing, the pitting machine comprises a base, the top end of the [...] Fuente: WIPO "stone fruits" |
jue, 9 mar 2023 | 1-AMINO-1-CYCLOPROPANECARBOXYLIC ACID FOR THINNING OF FRUITSThe present invention relates to methods of reducing crop load of woody perennial plants comprising applying 1 -amino- 1-cyclopropanecarboxylic acid to the plants prior to bloom. Fuente: WIPO "stone fruits" |
jue, 24 nov 2022 | METHODS AND COMPOSITIONS FOR GAMMA-DECALACTONE BIOSYNTHESIS IN FERMENTED BEVERAGESFuente: WIPO "stone fruits" |
jue, 1 sep 2022 | HYPERSPECTRAL IMAGE COMPRESSION USING A FEATURE EXTRACTION MODELDisclosed are techniques for obtaining tensor data representing a hyperspectral image, the hyperspectral image including a first portion depicting an object and a second portion depicting [...] Fuente: WIPO "stone fruits" |
jue, 16 jun 2022 | DEVICES, COMPOSITIONS AND METHODS FOR INSECT CONTROLThe present invention relates to compositions and devices for attracting, trapping and/or monitoring insects, more particularly Carpophilus beetles, such as stone fruit beetle and almond [...] Fuente: WIPO "stone fruits" |
mié, 30 mar 2022 | USE OF DISPENSING DEVICES IN AGRICULTURAL APPLICATIONSUse of a device D in agricultural applications, forestry or home and garden applications, wherein said device D is used for dispensing in the air, as a vapor, an active ingredient that [...] Fuente: WIPO "stone fruits" |
vie, 31 dic 2021 | Feeding and sequencing device for stone fruitsThe utility model discloses a stone fruit feeding and sequencing device which comprises a feeding frame, a bearing is installed on the frame wall of the feeding frame in a penetrating [...] Fuente: WIPO "stone fruits" |
jue, 30 sep 2021 | HYDRAULIC SHELL-SEED SEPARATORA method of separating a shell from a seed may involve introducing a feed stream containing shells of a fruit intermixed with seeds of the fruit into a separation column at a feed stream [...] Fuente: WIPO "stone fruits" |
jue, 9 sep 2021 | METHOD AND APPARATUS FOR REMOVING CYANIDE FROM STONE FRUIT DISTILLED LIQUORThe present disclosure belongs to the field of detection, and particularly, relates to a method ) and apparatus for removing cyanide from stone fruit distilled liquor. The method includes [...] Fuente: WIPO "stone fruits" |
mar, 7 sep 2021 | Dormancy breaking agent for breaking dormancy period of stone fruitsThe invention discloses a dormancy breaking agent for breaking the dormancy period of stone fruits, and belongs to the technical field of stone fruit cultivation preparations, wherein [...] Fuente: WIPO "stone fruits" |
jue, 15 jul 2021 | FRUIT THINNING METHOD WITH 1-AMINOCYCLOPROPANE CARBOXYLIC ACIDThe present invention relates to fruit thinning method with 1-aminocyclopropane carboxylic acid (ACC) to reduce crop load of stone fruit trees or pome fruit trees. Fuente: WIPO "stone fruits" |
jue, 3 jun 2021 | HIGHLY LOADED FORMULATIONS WITH INSECTICIDES OF THE KETOENOL CLASS FOR USE IN DRIP AND DRENCH APPLICATIONSThe present invention relates to solvent-free aqueous suspension concentrates having high active ingredient concentration, good biological efficacy and good rheological stability, and [...] Fuente: WIPO "stone fruits" |
jue, 22 abr 2021 | Formulation of insecticides comprising glycol ether solventsThe invention relates to insecticidal active ingredient formulations comprising at least one active ingredient or a combination of active ingredients in solid form having good storage [...] Fuente: WIPO "stone fruits" |
jue, 15 abr 2021 | FORMULATION OF INSECTICIDES COMPRISING PROPYLENE CARBONATEThe invention relates to insecticidal active ingredient formulations comprising at least one active ingredient or a combination of active ingredients in solid form having good storage [...] Fuente: WIPO "stone fruits" |
jue, 15 abr 2021 | Formulation of insecticidal mixtures comprising glycol ether solventsThe invention relates to insecticidal active ingredient formulations comprising at least one dissolved active ingredient and one active ingredient in solid form having good storage stability [...] Fuente: WIPO "stone fruits" |
jue, 4 feb 2021 | METHOD OF IMPROVING COLD STRESS TOLERANCE AND CROP SAFETYThe present invention relates to the use of Bacillus subtilis QST713, Bacillus subtilis var. amyloliquefaciens FZB24, and/or a mutant thereof for improving tolerance in a plant exposed [...] Fuente: WIPO "stone fruits" |
jue, 4 feb 2021 | TRELLIS PANELS FOR SUNLIGHT DELIVERY, SHOOT POSITIONING, AND CANOPY DIVISIONProvided herein are devices, systems, and methods for sunlight delivery, shoot positioning, canopy division, positioning fruit into distinct zones, managing fruit maturity and quality, [...] Fuente: WIPO "stone fruits" |
jue, 11 jun 2020 | METHODS FOR TREATING A FUNGAL INFECTION ON A STONE FRUIT TREEThe present invention provides a method for preventing or combating a fungal infection on a stone fruit tree or a part thereof, the method comprising applying Trichoderma atroviride [...] Fuente: WIPO "stone fruits" |
jue, 14 may 2020 | THERAPEUTIC MICROBIOTA FOR THE TREATMENT AND/OR PREVENTION OF DYSBIOSISDisclosed are methods and compositions for the prevention and treatment of dysbiosis and associated conditions. In particular, described herein are compositions of microbial consortia, [...] Fuente: WIPO "stone fruits" |
jue, 30 abr 2020 | USE OF AN EXTRACT OF PART OF A ROCKET PLANT FOR STIMULATING THE DEFENSES OF PLANTS AND TREES AND ASSOCIATED COMPOSITION AND METHODThe use of an extract of at least a part of rocket plants, preferably chosen from the group of rocket plants of the Eruca (Eruca sativa; Eruca vesicaria, etc.), Diplotaxis (Diplotaxis [...] Fuente: WIPO "stone fruits" |
jue, 17 oct 2019 | Formulation of insecticidal mixtures comprising propylene carbonateThe invention relates to: insecticidal active substance formulations comprising at least one dissolved and one solid active substance with good storage stability at high and low temperatures [...] Fuente: WIPO "stone fruits" |
jue, 17 oct 2019 | Solid formulation of insecticidal mixturesThe invention relates to solid formulations (in particular water-soluble granulates (SG)) of tetramic acid derivatives that have an insecticidal effect, to a method for the preparation [...] Fuente: WIPO "stone fruits" |
jue, 17 oct 2019 | Use of tetramic acid derivatives for controlling pests by watering or droplet applicationCompounds of the formula (II), where A, B, G, W, X, Y and Z can have the meanings provided in the description, are well-suited for fighting animal pests such as insects and/or red spider [...] Fuente: WIPO "stone fruits" |
vie, 14 jun 2019 | Post-harvest processing method and equipment for box-type stone fruits at edge of fruit fieldThe invention belongs to the field of agricultural product processing machinery, and relates to a post-harvest processing method and equipment for box-type stone fruits at the edge of [...] Fuente: WIPO "stone fruits" |
mié, 20 mar 2019 | NURSERY FRUIT TREE OF AT LEAST DOUBLE TRUNK TYPEThe present invention provides a method for producing a nursery fruit tree of at least double trunk type. The invention also provides a nursery fruit tree of at least double trunk type, [...] Fuente: WIPO "stone fruits" |
jue, 15 nov 2018 | FRUIT AND VEGETABLE ROTATION MECHANISM AND PEELING DEVICEIn an embodiment of a fruit and vegetable holder 101, a plurality of fruit and vegetable pins 103 that pierce and hold a fruit or vegetable and are formed such as to be sharp are arranged [...] Fuente: WIPO "stone fruits" |
jue, 8 nov 2018 | USE OF AN ACYCLIC PICOLINAMIDE COMPOUND AS A FUNGICIDE FOR CONTROL OF PHYTOPATHOGENIC FUNGI IN ORCHARD, VINEYARD AND PLANTATION CROPSThe present disclosure is related to the field of agrochemicals, including compound I and its use to control fungal diseases in agriculturally useful orchard, vineyard and plantation crops. Fuente: WIPO "stone fruits" |
jue, 4 oct 2018 | 1-AMINO-1-CYCLOPROPANECABOXYLIC ACID FORMULATIONSThe present invention relates to stable 1-amino-1-cyclopropaxieearboxy He acid formulations and methods of their use. Fuente: WIPO "stone fruits" |
jue, 4 oct 2018 | 1-AMINO-1-CYCLOPROPANECARBOXYLIC ACID FORMULATIONSThe present invention relates to stable 1-amino-1-cyclopropaxieearboxy He acid formulations and methods of their use. Fuente: WIPO "stone fruits" |
mié, 12 sep 2018 | USE OF FLUOPYRAM FOR CONTROLLING NEMATODES IN CROPSThe present invention relates generally to the use of N-{2-[3-chloro-5-(trifluoromethyl)-2-pyridinyl]ethyl}-2-(trifluoromethyl)benzamide (fluopyram) and compositions comprising fluopyram [...] Fuente: WIPO "stone fruits" |
jue, 26 jul 2018 | POST-HARVEST TREATMENT METHOD USING CLONOSTACHYS ROSEAThe present disclosure relates to a new post-harvest treatment method which can be applied to harvested agricultural produce to reduce post-harvest spoilage or decay. Fuente: WIPO "stone fruits" |
jue, 14 jun 2018 | HERBICIDAL COMBINATION CONTAINING TRIAFAMONE AND INDAZIFLAMThe invention relates to a herbicidal combination containing components (A) and (B), (A) being the compound and the salts thereof described by formula (A), and (B) being the compound [...] Fuente: WIPO "stone fruits" |
jue, 15 dic 2016 | DEVICE FOR CHOPPING FOOD AND FOR PITTING STONE FRUITThe invention relates to a device for chopping food, said device comprising a base part that has a receiving element for a cutting part, and an actuation part that can be fixed to the [...] Fuente: WIPO "stone fruits" |
mié, 30 nov 2016 | METHODS FOR CONTROLLING PHYTOPATHOGENIC NEMATODES BY COMBINATION OF FLUOPYRAM AND BIOLOGICAL CONTROL AGENTSThe present invention relates to the combined use of the nematicide Fluopyram and at least one biological control agent selected from the group consisting of Paecilomyces lilacinus, [...] Fuente: WIPO "stone fruits" |
jue, 15 sep 2016 | APPARATUS AND METHOD FOR CRACKING STONE FRUIT NUTSDisclosed is an apparatus and method for cracking stone fruit nuts. The apparatus comprises a frame (2) supporting a set of spaced apart jaw comprising a first jaw (4) and a second jaw [...] Fuente: WIPO "stone fruits" |
jue, 15 sep 2016 | Use of pesticidal active carboxamide derivative in soil and seed application and treatment methodsThe present invention relates to agricultural methods and the use of an insecticidal active carboxamide derivative in seed treatment and soil application methods. The insecticidal carboxamide [...] Fuente: WIPO "stone fruits" |
jue, 7 jul 2016 | BACILLUS AMYLOLIQUEFACIENS RTI301 COMPOSTIONS AND METHODS OF USE FOR BENEFITING PLANT GROWTH AND TREATING PLANT DISEASECompositions and methods include a new strain of Bacillus amyloliquefaciens having growth promoting activity and activity against plant pathogens. The compositions are useful for benefiting [...] Fuente: WIPO "stone fruits" |
jue, 7 jul 2016 | Bacillus amyloliquefaciens RTI472 compositions and methods of use for benefiting plant growth and treating plant diseaseCompositions and methods include a new strain of Bacillus amyloliquefaciens having activity against plant pathogens. The compositions are useful for benefiting plant growth and/or conferring [...] Fuente: WIPO "stone fruits" |
jue, 30 jun 2016 | BACILLUS LICHENIFORMIS RTI184 COMPOSITIONS AND METHODS OF USE FOR BENEFITING PLANT GROWTHCompositions and methods for application to plants are provided for a new strain of Bacillus licheniformis RTI184 having plant growth promoting activity. Compositions and extracts of [...] Fuente: WIPO "stone fruits" |
mié, 4 may 2016 | DEVICE FOR CHOPPING FOOD ITEMSThe invention relates to a food comminution device which has a base part, a first comminution tool, at least one further comminution tool, and a collecting container for comminuted foodstuff [...] Fuente: WIPO "stone fruits" |
mié, 4 may 2016 | FOOD-COMMINUTING DEVICEThe invention relates to a food-comminuting device, comprising a base part, which bears a cutting part, and comprising an actuating part, which is fastened to the base part in an articulated [...] Fuente: WIPO "stone fruits" |
jue, 10 mar 2016 | USE OF N-THIO-ANTHRANILAMIDE COMPOUNDS ON CULTIVATED PLANTSThe present invention relates to agricultural methods for controlling pests and/or increasing the plant health of a cultivated plant with at least one modification, using anthranilamide [...] Fuente: WIPO "stone fruits" |
jue, 3 mar 2016 | USE OF CHLORFENAPYR AND TEFLUBENZURON ON GENETICALLY MODIFIED PLANTSIn a first aspect, the present invention relates to uses and methods of application of a pesticidal mixture comprising chlorfenapyr and teflubenzuron, for protecting a genetically modified [...] Fuente: WIPO "stone fruits" |
jue, 17 dic 2015 | FOOD COMMINUTION DEVICEThe invention relates to a food comminution device having a base part, which bears a cutting part, and having an actuation part, which actuation part is articulatedly fixed to the base [...] Fuente: WIPO "stone fruits" |
jue, 3 sep 2015 | ACTIVE INGREDIENT FOR CONTROLLING TRUE SPIDER MITESThe present invention relates to novel uses of the compound of the formula (I) for controlling pests/spider mites from the order of Acari. Fuente: WIPO "stone fruits" |
jue, 6 ago 2015 | A METHOD OF INDUCING RIPENESS IN FRUITThe present invention is directed to compounds and methods for inducing ripeness in fruit, increasing the organoleptic properties of fruit, and/or improving desirable characteristics in fruit. Fuente: WIPO "stone fruits" |
jue, 16 jul 2015 | USE OF GIBBERELLIN 7 FOR THINNING OF STONE FRUITThe invention relates to the use of gibberellin 7 (GA7) for thinning of stone fruit, wherein the use comprises applying the GA7 to stone fruit in a first year by foliar spray within [...] Fuente: WIPO "stone fruits" |
mié, 15 jul 2015 | Use of a chemical agent for thinning of stone fruitThe invention relates to the use of gibberellin 7 (GA7) for thinning of stone fruit, wherein the use comprises applying the GA7 to stone fruit in a first year, to achieve thinning in [...] Fuente: WIPO "stone fruits" |
vie, 12 dic 2014 | DE-STONING OF BER FRUITSThe present disclosure provides a process for the de-stoning of ber (Ziziphusrnauritiana) fmits by means of a piercing unit. The de-stoned fruits obtained bythe process of the present [...] Fuente: WIPO "stone fruits" |
jue, 10 abr 2014 | USE OF ANTHRANILAMIDE COMPOUNDS IN SOIL AND SEED TREATMENT APPLICATION METHODSThe present invention relates to agricultural methods using anthranilamide compounds of formula (I) wherein R1, R2, R3, R4, R5, R6, R7 and k are as defined in the description; and their [...] Fuente: WIPO "stone fruits" |
jue, 27 mar 2014 | METHOD FOR MANUFACTURING UNDILUTED EXTRACT AND EXTRACTED LIQUOR OF STONE FRUITS WITH REDUCED ETHYL CARBAMATEThe present invention relates to a method for manufacturing undiluted extract and extracted liquor of stone fruits capable of: markedly reducing ethyl carbamate content, the ethyl carbamate [...] Fuente: WIPO "stone fruits" |
mar, 28 ene 2014 | Rotary brush harvesters and methods of using the sameAutomated rotary brush harvesters that reduce or prevent damage to fruit or other crops (“produce”) when they are removed from trees or bushes, and methods of using such harvesters [...] Fuente: WIPO "stone fruits" |
jue, 7 nov 2013 | Use of Tetramic Acid Derivates for Controlling Animal Pests after Treatment of the Trunk, the Branches, the Influorescences or the BudsThe present invention relates to the use of tetramic acid derivatives of the formulae (I) or (II) for controlling animal pests after stem treatments (spraying on, painting on, injecting, [...] Fuente: WIPO "stone fruits" |
jue, 15 ago 2013 | COMPOSITIONS AND METHODS FOR USE IN PROMOTING PRODUCE HEALTHProvided herein are compositions comprising one or more of a stilbenoid, stilbenoid derivative, stilbene, or stilbene derivative and a produce coating. The resulting compositions are [...] Fuente: WIPO "stone fruits" |
mié, 5 jun 2013 | USE OF SUCCINATE DEHYDROGENASE INHIBITOR AND RESPIRATORY CHAIN COMPLEX III INHIBITOR FOR IMPROVING THE RATIO OF HARMFUL TO BENEFICIAL MICROORGANISMSThe present invention relates to the use of succinate dehydrogenase inhibitors and/or complex III inhibitors for controlling undesired fungal pathogens and simultaneously improving the [...] Fuente: WIPO "stone fruits" |
jue, 16 may 2013 | COMBINATIONS OF ANTIFUNGAL COMPOUNDS AND TEA TREE OILThere is disclosed a method for treating a plant infection caused by a fungus of the phylum basidiomycota, comprising applying to the plant a combination of tea tree oil (TTO) and a [...] Fuente: WIPO "stone fruits" |
jue, 21 mar 2013 | METHODS FOR DELAYING BUD BREAK BY APPLYING ABA ANALOGSThe present invention is directed to methods for delaying bud break of perennial plants by applying abscisic acid ("ABA") analogs to the plants before cold temperature induced dormancy [...] Fuente: WIPO "stone fruits" |
dom, 3 feb 2013 | ACTIVE COMPOUND COMBINATIONS WITH INSECTICIDE AND/OR ACARICIDE ACTIVITY WITH AT LEAST ONE BENEFICIAL SPECIES SELECTED FROM PHYTOSEIIDAE SPECIESFuente: WIPO "stone fruits" |
jue, 23 ago 2012 | METHOD FOR CONTROLLING PHYTOPATHOGENIC FUNGIThe present invention relates to the use of a potassium salt of phosphorous acid and dithianon in agriculture and to a composition comprising a potassium salt of phosphorous acid and dithianon. Fuente: WIPO "stone fruits" |
jue, 7 jun 2012 | USE OF FLUOPYRAM FOR CONTROLLING NEMATODES IN CROPS AND FOR INCREASING YIELDThe present invention relates generally to the use of pyridylethylbenzamide derivatives for controlling nematodes and to methods particularly useful for controlling nematodes and/or [...] Fuente: WIPO "stone fruits" |
jue, 24 may 2012 | BITTERNESS SUPPRESSANTThe present invention relates to a bitterness suppressant derived from a juice of a stone fruit, and more specifically to a bitterness suppressant characterized by being derived from [...] Fuente: WIPO "stone fruits" |
jue, 16 feb 2012 | Method for improved use of the production potential of genetically modified plantsThe invention relates to a method for improving the utilization of the production potential of a genetically modified plant where the plant is treated with an effective amount of at [...] Fuente: WIPO "stone fruits" |
jue, 2 feb 2012 | USE OF SUCCINATE DEHYDROGENASE INHIBITORS AND/OR RESPIRATORY CHAIN COMPLEX III INHIBITORS FOR IMPROVING THE RATIO OF HARMFUL TO BENEFICIAL MICROORGANISMSThe present invention relates to the use of succinate dehydrogenase inhibitors and/or complex III inhibitors for controlling undesired fungal pathogens and simultaneously improving the [...] Fuente: WIPO "stone fruits" |
jue, 5 ene 2012 | USE OF SYNTHETIC AND BIOLOGICAL FUNGICIDES IN COMBINATION FOR CONTROLLING HARMFUL FUNGIThe present invention relates to the combined use of synthetic fungicides and biological control agents for controlling harmful fungi. To be more precise, the invention relates to a [...] Fuente: WIPO "stone fruits" |
jue, 8 dic 2011 | Bitterness-suppressing agentA bitterness-suppressing agent derived from a juice of a stone fruit, more specifically a bitterness-suppressing agent characterized by being produced by removing a low-molecular-weight [...] Fuente: WIPO "stone fruits" |
jue, 17 nov 2011 | Methods for improving fruit production and fruit qualityDisclosed herein are methods for improving fruit production or fruit quality in fruit trees, such as decreasing cold damage, increasing fruit size, increasing fruit quality, and/or increasing [...] Fuente: WIPO "stone fruits" |
jue, 22 sep 2011 | Acaricidal and/or insecticidal active ingredient combinationsThe present invention relates to active ingredient combinations which are composed of a known dihydrofuranone derivative on the one hand and of other known active pesticidal ingredients [...] Fuente: WIPO "stone fruits" |
mié, 9 mar 2011 | Use of tetramic acid derivatives for controlling pests by dipping applicationCompounds of the formula (I) in which A, B, G, W, X, Y and Z can have the meanings given in the description are highly suitable for controlling animal pests such as insects and/or [...] Fuente: WIPO "stone fruits" |
mié, 19 ene 2011 | Use of tetramic acid derivatives for controlling pests by drip application onto soilCompounds of the formula (I) in which A, B, G, W, X, Y and Z can have the meanings given in the description are highly suitable for controlling animal pests such as insects and/or [...] Fuente: WIPO "stone fruits" |
jue, 23 dic 2010 | Use of Tetramic Acid Derivatives for Controlling Animal Pests After Treatment of the Trunk, the Branches, the Influorescences or the BudsThe present invention relates to the use of tetramic acid derivatives of the formulae (I) or (II) for controlling animal pests after stem treatments [...] Fuente: WIPO "stone fruits" |
jue, 16 dic 2010 | 1-AMINOCYCLOPROPANE CARBOXYLIC ACID AS A FRUIT THINNERThe present invention relates to agricultural methods and compositions of 1- aminocyclopropane carboxylic acid (ACC) alone or in combination with 2- chloroethylphosphonic acid (ethephon) [...] Fuente: WIPO "stone fruits" |
jue, 9 dic 2010 | Combinations of Flubendiamide and Beneficial SpeciesThe novel combinations of flubendiamide and beneficial species comprising flubendiamide and at least one beneficial species from the orders or suborders of the Araneae, Acari, Dermaptera, [...] Fuente: WIPO "stone fruits" |
jue, 25 nov 2010 | Classification of Impinging BodiesObjects impinging on an impingement body may be classified, with regard to their properties, in an efficient and highly reliable manner when the chronological acceleration profile caused [...] Fuente: WIPO "stone fruits" |
jue, 27 may 2010 | CONTROLLING PESTS BY COMBINING INSECTICIDES AND TRANSGENIC PLANTS BY APPLYING DIRECTLY TO LEAVES AND ROOTSThe invention relates to a method for controlling pests using a combination of insecticides and transgenic plants and consequently improving the utilization of the production potential [...] Fuente: WIPO "stone fruits" |
jue, 27 may 2010 | Method for better utilizing the production potential of transgenic plantsThe invention relates to a method for improving the utilization of the production potential of transgenic plants which comprises treating the plant with active compound combinations [...] Fuente: WIPO "stone fruits" |
jue, 29 abr 2010 | USE OF CARBOXYLIC AMIDE FUNGICIDES ON TRANSGENIC PLANTSThe present invention relates to a method for controlling pests and/or increasing the plant health in cultivated plants comprising the application of a pesticide to the plant with at [...] Fuente: WIPO "stone fruits" |
jue, 29 abr 2010 | USE OF NEONICOTINOIDES ON CULTIVATED PLANTSThe present invention relates to a method for controlling pests or increasing the plant health in a cultivated plant comprising the application of a neonicotinoide to the plant with [...] Fuente: WIPO "stone fruits" |
jue, 4 mar 2010 | ACTIVE COMPOUND COMBINATIONS WITH INSECTICIDAL AND ACARICIDAL PROPERTIESThe novel active compound combinations consisting, firstly, of cyclic ketoenols and, secondly, of beneficial species (natural enemies) have very good insecticidal and/or acaricidal properties. Fuente: WIPO "stone fruits" |
jue, 25 feb 2010 | Active compound combinations having insecticidal and acaricidal propertiesThe novel active compound combinations consisting, firstly, of cyclic ketoenols and, secondly, of beneficial species (natural enemies) have very good insecticidal and/or acaricidal properties. Fuente: WIPO "stone fruits" |
jue, 25 feb 2010 | Post-harvest treatmentThe present invention relates to methods for the protection of harvested fruit, cutflowers or vegetables against decay caused by certain storage diseases or disorders expressed in storage [...] Fuente: WIPO "stone fruits" |
mié, 16 sep 2009 | Uses of fluopyramThe present invention relates to the use of N-{[3-chloro-5-(trifluoromethyl)-2-pyridinyl]ethyl}-2,6-dichlorobenzamide (fluopyram) and of compositions comprising fluopyram and further [...] Fuente: WIPO "stone fruits" |
jue, 9 abr 2009 | METHOD FOR THE IMPROVED USE OF THE PRODUCTION POTENTIAL OF TRANSGENIC PLANTSThe invention relates to a method for improving the utilization of the production potential of transgenic plants by treating the plant with an effective amount of at least one compound [...] Fuente: WIPO "stone fruits" |
jue, 15 ene 2009 | Active agent combinations with insecticidal and acaricidal propertiesThe novel active agent combinations, which consist of cyclic ketoenols, especially pyrrolidine-2,4-dione derivatives, and of beneficial organisms (natural enemies), have very good insecticidal [...] Fuente: WIPO "stone fruits" |
jue, 8 ene 2009 | Use of Tetramic Acid Derivatives for Controlling Insects from the Genus of the Plane Lice (Sternorrhyncha)The present invention relates to the use of tetramic acid derivatives of the formula (I) in which A, B, G, W, X, Y and Z are as defined above for [...] Fuente: WIPO "stone fruits" |
jue, 25 dic 2008 | Use of S-abscisic acid for improving fruit set and producing parthenocarpic fruits and as a growth inhibitorS-abscisic acid is used for promoting fruit set and/or for producing parthenocarpic fruits in useful plants. S-abscisic acid is also used as a growth inhibitor in useful plants. Methods [...] Fuente: WIPO "stone fruits" |
jue, 4 dic 2008 | Use of tetramic acid derivatives for insect controlThe invention relates to the use of compounds of formula (I), for the control of insects of the order of beetles (Coleoptera), thrips (Thysanoptera), bugs (Hemiptera), flies (Diptera), [...] Fuente: WIPO "stone fruits" |
jue, 23 oct 2008 | METHOD FOR IMPROVED UTILIZATION OF THE PRODUCTION POTENTIAL OF TRANSGENIC PLANTSThe invention relates to a method for better utilising the production potential of transgenic plants. Said plant is treated with combinations of active substances containing an active [...] Fuente: WIPO "stone fruits" |
jue, 23 oct 2008 | PEST CONTROL USING A COMBINATION OF INSECTICIDES AND TRANSGENIC PLANTS BY MEANS OF LEAF AND DRENCHING APPLICATIONThe invention relates to a method for controlling pests by combining insecticides and transgenic plants and as a result for better utilizing the production potential of transgenic plants. [...] Fuente: WIPO "stone fruits" |
jue, 7 ago 2008 | TETRAMIC ACID DERIVATIVES FOR USE IN THE CONTROL OF INSECTS OF THE PLANT LOUSE SPECIES STERNORRHYNCHAFuente: WIPO "stone fruits" |
jue, 22 nov 2007 | USE OF TETRAMIC ACID DERIVATIVES FOR CONTROLLING INSECTS FROM THE ORDER BEETLES (COLEOPTERA), THRIPS (TYSANOPTERA), BUGS (HEMIPTERA), FLIES (DIPTERA), LEAFHOPPERS (AUCHENORRHYNCHA) AND THE FAMILIES GALL MIDGES (CECIDOMYIIDAE), LEAF MINERS (GRACILLARIIDAE), TORTRIX MOTHS (TORTRICIDAE) AND SAWFLIES (TENTHREDINIDAE)The invention relates to the use of compounds of formula (I), for the control of insects of the order of beetles (Coleoptera), thrips (Thysanoptera), bugs (Hemiptera), flies (Diptera), [...] Fuente: WIPO "stone fruits" |
jue, 8 nov 2007 | USE OF TETRAMIC ACID DERIVATIVES FOR CONTROLLING PESTS BY DRENCHING, DRIP APPLICATION, DIP APPLICATION OR SOIL INJECTIONCompounds of the formula (I) (see formula I) in which A, B, G, W, X, Y and Z can have the meanings given in the description are highly suitable for controlling animal pests such as insects [...] Fuente: WIPO "stone fruits" |
jue, 20 sep 2007 | METHOD FOR IMPROVING THE TOLERANCE OF PLANTS TO CHILLING TEMPERATURES AND/OR FROSTThe present invention relates to the use of an active compound that inhibits the mitochondrial breathing chain at the level of the b/c1 complex for improving the tolerance of plants [...] Fuente: WIPO "stone fruits" |
jue, 20 sep 2007 | METHOD FOR IMPROVING THE TOLERANCE OF PLANTS TO CHILLING TEMPERATURES AND/OR FROST USING A STROBILURIN COMPOUNDThe present invention relates to the use of a strobilurin compound for improving the tolerance of plants to low temperatures ranging from +15°C to -15.degreeC, wherein the strobilurin [...] Fuente: WIPO "stone fruits" |
jue, 16 ago 2007 | Use of tetramic acid derivatives for the control of insects of the plant louse species (Sternorrhyncha)The invention relates to the use of tetramic acid derivatives of formula (I), where A, B, G, W, X, Y and Z have the meanings given before for the control of insects of the plant louse [...] Fuente: WIPO "stone fruits" |
jue, 1 feb 2007 | Development of diagnostic kit against the recombinant coat protein of prunus necrotic ringspot virusThe present invention deals with a set of primers of sequence ID 1: upstream primer AACTGCAGATGGTTTGCCGAATTTGCAA and sequence ID 2: downstream primer GCTCTAGACTAGATCTCAAGCAGGTC useful [...] Fuente: WIPO "stone fruits" |
jue, 21 sep 2006 | METHOD OF INHIBITING ETHYLENE PRODUCTION IN PLANTSMethods of inhibiting ethylene production in a plant are provided that involve contacting a plant or plant part with an inhibitor of 1-aminocyclopropane-l-carboxylic acid oxidase (ACCO). [...] Fuente: WIPO "stone fruits" |
jue, 27 jul 2006 | USE OF TETRAMIC ACID DERIVATIVES FOR CONTROLLING INSECTS FROM THE GENUS OF THE PLANT LICE (STERNORRHYNCHA)The present invention relates to the use of a compound of the formula (I):(see formula I)wherein: G is CO2C2H5, in the form of an isomer mixture or pure isomer for controlling insects [...] Fuente: WIPO "stone fruits" |
jue, 13 jul 2006 | COMPOSITIONS AND METHODS TO IMPROVE THE STORAGE QUALITY OF PACKAGED PLANTSThe present invention relates to a composition comprising a cyclopropene, for example 1-MCP, encapsulated in a cyclodextrin matrix, a hygroscopic compound, yeast and/or other enzymes [...] Fuente: WIPO "stone fruits" |
jue, 25 ago 2005 | METHOD FOR CONTROL OF GROUND SHOOTS OF TRUNK VEGETATION THROUGH APPLYING THEREUPON A PROTOPORPHYRINOGEN OXIDASE ENZYME-INHIBITING HERBICIDEProtoprophyrinogen oxidase enzyme-inhibiting herbicides are useful in a method for controlling unwanted ground shoots of vines and other trunk vegetation. Of particular interest is the [...] Fuente: WIPO "stone fruits" |
jue, 26 may 2005 | Food product and support stick thereforA food product made from a support stick that is configured to inserted into and securely hold food items having a central core section such as stone fruits and pome fruits. The food [...] Fuente: WIPO "stone fruits" |
jue, 30 sep 2004 | USE OF ACYLCYCLOHEXANEDIONE DERIVATIVES FOR IMPROVING THE TOLERANCE OF PLANTS TO COLD AND/OR FROSTThe invention relates to the use of acylcyclohexanedione derivatives for improving the tolerance of plants to cold and/or frost. Fuente: WIPO "stone fruits" |
jue, 26 ago 2004 | Fungicidal composition and use of this composition for controlling plant diseasesThe present invention relates to a fungicidal composition comprising at least one fungicidal compound of the family of anilinopyrimidines and imazalil, and the use of such a composition [...] Fuente: WIPO "stone fruits" |
jue, 17 jun 2004 | Yeast Metschnikowia fructicola NRRL Y-30752 for inhibiting deleterious microorganisms on plantsA biologically pure culture of a yeast of the species Metschnikowia fructicola. The yeast is identified as NRRL Y-30752 and is capable of inhibiting growth of a deleterious micro-organism [...] Fuente: WIPO "stone fruits" |
jue, 29 abr 2004 | A method of controlling fungal pathogens and agents useful for sameAn anti-fungal composition comprising an effective amount of a sugar acid selected from the group consisting of mannonic acid, gluconic acid and galactonic acid when used to prevent [...] Fuente: WIPO "stone fruits" |
mié, 26 mar 2003 | NOVEL ANTAGONISTIC YEAST USEFUL IN CONTROLLING SPOILAGE OF AGRICULTURAL PRODUCE METHODS OF USE THEREOF AND COMPOSITIONS CONTAINING SAMEY-27328 and is capable of inhibiting growth of a deleterious micro-organism on a portion of a plant to which a biologically effective amount of a culture of the yeast is applied. Further [...] Fuente: WIPO "stone fruits" |
jue, 13 mar 2003 | Use of neonicotinoids in pest controlThere is now described a method of controlling pests with nitroimino- or nitroguanidino-compounds; more specifically a method of controlling pests in and on transgenic crops of useful [...] Fuente: WIPO "stone fruits" |
jue, 3 oct 2002 | DETECTION OF FUNGAL PATHOGENS USING THE POLYMERASE CHAIN REACTIONThe present invention relates to the use of primers in polymerase chain assays for the detection of fungal pathogens Colletotrichum acutatum, Alternaria spp., and Cladosporium carpophilum. [...] Fuente: WIPO "stone fruits" |
jue, 1 ago 2002 | A novel antagonistic yeast useful in controlling spoilage of agricultural produce, methods of use thereof and compositions containing sameA biologically pure culture of a yeast of the species Metschnikowia fructicola. The yeast is identified as NRRL Y-27328 and is capable of inhibiting growth of a deleterious micro-organism [...] Fuente: WIPO "stone fruits" |
mar, 7 may 2002 | Fruit kernel protein and lipid extract compositionsProtein and lipid extract isolate compositions of fruit kernel, particularly stone fruit kernel, origin. The composition is obtained from fruit kernels, particularly stone fruit kernels, [...] Fuente: WIPO "stone fruits" |
jue, 2 ago 2001 | COMPOSITION AND METHOD FOR EARLY BLOOM THINNING OF FRUIT TREES AND CONTROLLING CRACKING OF FRUITSA composition and method for early bloom thinning of fruit trees and controlling cracking, wherein the composition provides that glyceride type of lipids are effective compounds for [...] Fuente: WIPO "stone fruits" |
jue, 21 sep 2000 | VE PROTEIN AND NUCLEIC ACID SEQUENCES, COMPOSITIONS, AND METHODS FOR PLANT PATHOGEN RESISTANCEThe invention provides polynucleotides which, when present in a plant, confer on the plant resistance to Verticillium species. The polynucleotides of the invention are useful for producing [...] Fuente: WIPO "stone fruits" |
jue, 22 jul 1999 | USE OF INSECTICIDES IN PEST CONTROLThere is now described a method of controlling pests with pymetrozine, profenofos, a benzoylurea-derivative or a carbamat-derivative; more specifically a method of controlling pests [...] Fuente: WIPO "stone fruits" |
jue, 22 jul 1999 | USE OF NEONICODINOIDS ON TRANSGENIC PLANTSThere is now described a method of controlling pests with nitroimino- or nitroguanidino-compounds; more specifically a method of controlling pests in and on transgenic crops of useful [...] Fuente: WIPO "stone fruits" |
jue, 8 jul 1999 | USE OF MACROLIDES IN PEST CONTROLThere is now described a method of controlling pests with macrolide compounds; more specificallyA) a method of controlling pests in and on transgenic crops of useful plants, such as, [...] Fuente: WIPO "stone fruits" |
jue, 17 mar 1994 | PIT DETECTOR AND METHODA method and apparatus for detecting the presence of an impurity within a substantially spherical object, such as piece of stone fruit. An infrared point source light emitting diode [...] Fuente: WIPO "stone fruits" |
mar, 1 feb 1994 | Material reserving, dispensing and planing devices for a stone fruit biscuit machineMaterial reserving, dispensing and planing devices for a stone fruit biscuit machine comprising a meterial reserving device, a material dispensing device, a material planing device and [...] Fuente: WIPO "stone fruits" |
jue, 11 nov 1993 | NOVEL METHODS AND COMPOSITIONS FOR FRUIT THINNINGThe invention described here concerns the unique utility of fatty acids and their derivatives to act as fruit thinning agents. Proper use fo the methods and compositions will result [...] Fuente: WIPO "stone fruits" |
mar, 7 sep 1993 | Methods for fruit thinning comprising applying fatty acids or derivatives thereof to flowersThe invention described here concerns the unique utility of fatty acids and their derivatives to act as fruit thinning agents. Proper use of the methods and compositions will result [...] Fuente: WIPO "stone fruits" |
jue, 29 oct 1992 | YEASTS AS A BIOCONTROL FOR MICROBIAL DISEASES OF FRUITCompositions for the treatment/prevention of microbial diseases of fruit comprising an effective amount of at least one yeast strain selected from the species Rhodotorula glutinis (Fres.) [...] Fuente: WIPO "stone fruits" |
mar, 2 jun 1992 | Process for thinning of stone fruit blossoms using alkoxylated aminesA process for thinning stone fruit blossoms is disclosed. In the process, a compound selected from certain alkoxylated amines and alkoxylated quaternary ammonium compounds is applied [...] Fuente: WIPO "stone fruits" |
mié, 29 abr 1992 | PROCESS FOR THE THINNING OF STONE FRUIT BLOSSOMSA process for thinning stone fruit blossoms is disclosed. In the process, a compound selected from certain alkoxylated amines and alkoxylated quaternary ammonium compounds is applied [...] Fuente: WIPO "stone fruits" |
mar, 31 dic 1991 | Method and apparatus for detecting pits in fruitA method and apparatus for the detection of pits and abnormalities in various stone fruits. The apparatus transmits a first plurality of beams of light (18) across inspection zone (14) [...] Fuente: WIPO "stone fruits" |
vie, 27 dic 1991 | PROCESS FOR THINNING OF STONE FRUIT BLOSSOMSA process for thinning stone fruit blossoms is disclosed. In the process, a compound selected from certain alkoxylated amines and alkoxylated quaternary ammonium compounds is ap- plied [...] Fuente: WIPO "stone fruits" |
mar, 16 ago 1988 | Postharvest biological control of stone fruit brown rot by bacillus subtilisA method for treating postharvest stone fruit to prevent or inhibit brown rot of stone fruit with effective amounts of any of the following active ingredients in a carrier is disclosed: [...] Fuente: WIPO "stone fruits" |
mar, 8 dic 1987 | Automatic machine for making stone fruit biscuitAn automatic machine for making stone fruit biscuit in seven consequent steps to make stone fruit biscuit, that is, material reserving, material restoring, planing, sucking, moulding, [...] Fuente: WIPO "stone fruits" |
mié, 14 ene 1987 | AUTOMATIC BISCUIT MAKING MACHINEAn automatic machine for making stone fruit biscuits in seven consequent steps to make stone fruit biscuits that is, material reserving, material restoring, planing, sucking, moulding, [...] Fuente: WIPO "stone fruits" |
mar, 15 ene 1980 | Stone fruit cutterA stone fruit cutting apparatus for slicing apricots, this apparatus having a pair of substantially vertical belts defining a channel to guide and carry the fruit therealong to the cutting [...] Fuente: WIPO "stone fruits" |
jue, 4 may 1978 | AGRICULTURAL AND HORTICULTURAL COMPOSITIONS AND PROCESS1509195 Augmenting fruit production W W SCHWABE and G K GOLDWIN 2 May 1975 [7 May 1974 15 Oct 1974] 20071/74 and 44635/74 Heading C1B A composition for augmenting fruit production comprises [...] Fuente: WIPO "stone fruits" |
mié, 8 sep 1971 | PROCESS FOR THE PREPARATION OF XYLOSE SOLUTIONS1,245,486. Xylose solutions. SUD-CHEMIE A.G. 4 Dec., 1969, No. 59354/69. Heading C2C. Aqueous xylose solutions are prepared substantially free of crystallization-inhibiting substances [...] Fuente: WIPO "stone fruits" |
jue, 29 sep 1927 | Improvements in and relating to machines for fruit stoning277,770. Leonhardt, H. July 12, 1926. Stoning fruit. - A fruit-stoning machine comprises a rotating member A carrying segments B hinged thereto, the segments being provided with rubber [...] Fuente: WIPO "stone fruits" |
jue, 6 nov 1913 | An Improved Appliance for Stoning Cherries and other Stone Fruit.29,635. Barnes, J. Dec. 24. Stoning f r u i t .- Consists in forming from a metal blank the frame o f an appliance for stoning cherries &c. in which the frame, carrying a sliding plunger [...] Fuente: WIPO "stone fruits" |
jue, 14 mar 1912 | Improvements in Machines for Pitting or Stoning Fruit.26,139. Lake, H. W., [Rheinstrom & Sons Co., I.]. Nov. 22. Stoning olives, cherries, &c.-A machine for stoning olives, cherries, &c. comprises a vertical rotating wheel 5 fitted with [...] Fuente: WIPO "stone fruits" |