Fecha de publicación: 31/07/2009 Fuente: WIPO "stone fruits" 1. Primers useful for detection of Prunus necrotic ringspot virus (PNRSV) in plants,comprising the following sequence:Sequence ID 1: upstream primer AACTGCAGATGGTTTGCCGAATTTGCAA Sequence ID 2: downstream primer GCTCTAGACTAGATCTCAAGCAGGTC2. A method for detection of Prunus necrotic ringspot virus (PNRSV) in plants, whereinthe said method comprising the steps of:b) providing a purified coat protein of PNRSV by using designed primers ofSequence  ID  1:  upstream primer AACTGCAGATGGTTTGCCGAATTTGCAA Sequence ID 2: downstream primer GCTCTAGACTAGATCTCAAGCAGGTC;b) preparing polyclonal antibodies against PNRSV coat protein obtained from step (a);c) performing direct antibody sandwich enzyme linked immunosorbent assay (DAS ELISA) for detection of PNRSV.