Fuente:
WIPO "tobacco agriculture"
The invention discloses a primer for authenticating the expression quantities of sucrose phosphate synthase genes of flue-cured tobaccos, and an application and a method thereof. The DNA sequence of the primer for authenticating the expression quantities of sucrose phosphate synthase genes of flue-cured tobaccos is SPS-F2: 5' GGTGGTTTTCGTTGGAGAAA 3' SPS-R2: 5' CATTAGGGCTGTCGAATGGT 3'. The application refers to an application of the primer for authenticating the expression quantities of sucrose phosphate synthase genes of flue-cured tobaccos in authenticating the expression quantities of the sucrose phosphate synthase genes of the flue-cured tobaccos. The method comprises the steps of pretreatment and real-time fluorescent quantitative PCR reaction. According to the invention, through determining the expression conditions of SPS genes of flue-cured tobaccos in five growth periods such as the resettling period, the fast-growing period, the squaring period, the period after the topping, and the maturation period, the change characteristics of the SPS genes in different growth periods are determined, the molecular characteristics of sucrose metabolism of flue-cured tobaccos in different growth periods are revealed, and a theoretical basis is provided for the quality improvement of flue-cured tobaccos.