Method and kit for detecting N'orthologous gene N 'alta in tobacco

Fecha de publicación: 01/02/2022
Fuente: WIPO "tobacco agriculture"
The invention relates to a method and a kit for detecting an N'orthologous gene N 'alta in tobacco. According to the detection method, a primer for detecting an N 'alta gene is included, and the base sequence of the primer is as follows: Alata F1: GTTTGAAGTTGAAGGTTCTCCTAAGATTGAAlata R1:GCTTGGCTGCTAAATGTTTTCAAATTG. The method has the beneficial effect that a stable amplification system is constructed. The amplification efficiency can be optimal by adjusting reaction conditions such as primer concentration, annealing temperature and the like. A reliable, simple and convenient detection method can be provided for effectively detecting the N '-alta gene transferred in target tobacco, whether the N'-alta gene exists or not can be judged by judging whether a strip is obtained through amplification or not in most cases, sequencing is not needed, and the method is suitable for large-scale screening and transferring in tobacco breeding to obtain a group with the N '-alta gene.